FlyBase Allele Report: Scer\GAL4[srp.Hemo]

General Information

Symbol

Scer\GAL4^srp.Hemo

Species

S. cerevisiae

Name

FlyBase ID

FBal0197807

Feature type

allele

Associated gene

Scer\GAL4

Associated Insertion(s)

Carried in Construct

P{srp.Hemo-GAL4}

Also Known As

srp-Gal4, srpHemo-Gal4, srpHemoGAL4, srp(hemo)Gal4, srp.Hemo-GAL4, serpentHemoGAL4, serpent-GAL4, serpentGal4

Transgenic product class

Mutagen

in vitro construct - regulatory fusion

Nature of the Allele

Transgenic product class

Mutagen

in vitro construct - regulatory fusion

(Bruckner et al., 2004)

Progenitor genotype

Carried in construct

P{srp.Hemo-GAL4}

Cytology

Description

Expression of a GAL4 driver is under the control of 2 genomic sequences from upstream of srp amplified with AGGGTACCCTACTGCTTCCCACTCTAAGACTTCCAGTTTTAGGCTACG (sense) and GGAATTCGGCAATGCCCCACCCCTTGGCTGGACGG (antisense) as well as CGCGGTACCCAGCGGGAGCAACAGGATCAAATGCAGCAGCG (sense) and CGCGGTACCTATGGGATCCGTGCTGGGGTAGTGCTCGTAGAGC (antisense).

(Bruckner et al., 2004)

Allele components

Component

Use(s)

Regulatory region(s)

srp

Encoded product / tool

GAL4

binary expression system - driver

Mutations Mapped to the Genome

Curation Data

Type

Location

Additional Notes

References

Variant Molecular Consequences

Associated Sequence Data

DDBJ / EMBL / GenBank

DNA sequence

Protein sequence

UniProtKB/Swiss-Prot

UniProtKB/TrEMBL

Expression Data

Reporter Expression

distribution deduced from reporter (Gal4 UAS)

Stage

Tissue/Position (including subcellular localization)

Reference

embryonic stage

embryonic/larval hemocyte

(Kuraishi et al., 2009)

embryonic stage 9

embryonic hemocyte anlage

(Bruckner et al., 2004)

embryonic stage 9 -- 17

procrystal cell

(Bruckner et al., 2004)

embryonic stage 10 -- 15

embryonic/larval hemocyte

(Bruckner et al., 2004)

embryonic/larval head mesoderm derived hemocyte

(Bruckner et al., 2004)

embryonic stage 10 -- 17

embryonic/larval plasmatocyte

(Bruckner et al., 2004)

embryonic/larval crystal cell

(Bruckner et al., 2004)

embryonic stage 12 -- 15

embryonic/larval plasmatocyte

(Weavers et al., 2016)

embryonic stage 12 -- 17

embryonic/larval hemocyte

(Martinek et al., 2008)

embryonic stage 14 -- 17

embryonic/larval hemocyte

(Wood et al., 2006)

embryonic stage 15 -- 17

embryonic/larval hemocyte

(Bruckner et al., 2004)

embryonic stage 16 -- 17

embryonic/larval hemocyte

(Bunt et al., 2011)

larval stage

embryonic/larval pericardial cell

(Pendse et al., 2013)

embryonic/larval garland cell

(Pendse et al., 2013)

embryonic/larval hemocyte

(Pendse et al., 2013, Matova and Anderson, 2006)

embryonic/larval lymph gland

(Matova and Anderson, 2006)

first instar larval stage -- third instar larval stage

embryonic/larval pericardial cell

Comment: from 48 hr AEL

(Das et al., 2008)

Additional Information

Statement

Reference

Drives expression in hemocytes and pericardial cells (nephrocytes) from embryonic stage 9 through all larval stages.

(FlyBase Curators, 2017)

Scer\GAL4^srp.Hemo drives expression in nephrocytes and hemocytes

(Pendse et al., 2013)

Scer\GAL4^srp.Hemo drives expression in all hemocytes and macrophages at all embryonic stages, as well as in the head mesoderm that gives rise to hemocytes beginning at embryonic stage 9.

(Bruckner et al., 2004)

Marker for

embryonic/larval hemocyte

(Bunt et al., 2011, Martinek et al., 2008)

embryonic/larval pericardial cell

(Das et al., 2008)

hemocyte

(Siekhaus et al., 2010, Kuraishi et al., 2009)

Reflects expression of

srp

(Weavers et al., 2016, Pendse et al., 2013, Bunt et al., 2011, Kuraishi et al., 2009, Das et al., 2008, Martinek et al., 2008, Wood et al., 2006, Bruckner et al., 2004)

Reporter construct used in assay

Human Disease Associations

Disease Ontology (DO) Annotations

Models Based on Experimental Evidence ( 0 )

Disease

Evidence

References

Modifiers Based on Experimental Evidence ( 0 )

Disease

Interaction

References

Comments on Models/Modifiers Based on Experimental Evidence ( 0 )

Disease-implicated variant(s)

Phenotypic Data

Phenotypic Class

abnormal cell migration | embryonic stage 12, with C1GalTA^GD1019

(Valoskova et al., 2019)

abnormal cell migration | embryonic stage 12, with Qsox1^KK101108

(Valoskova et al., 2019)

abnormal cell migration | embryonic stage, with atos^GD14092

(Emtenani et al., 2022)

abnormal cell migration | embryonic stage, with atos^HMS00234

(Emtenani et al., 2022)

abnormal cell migration | embryonic stage, with atos^KK100508

(Emtenani et al., 2022)

abnormal cell migration | embryonic stage, with blw^GD11030

(Emtenani et al., 2022)

abnormal cell migration | embryonic stage, with Cyt-c1^KK108213

(Emtenani et al., 2022)

abnormal cell migration | embryonic stage, with pths^GD14168

(Emtenani et al., 2022)

abnormal cell migration | embryonic stage, with UQCR-C1^KK108539

(Emtenani et al., 2022)

abnormal cell migration | embryonic stage, with UQCR-C2^KK108812

(Emtenani et al., 2022)

abnormal cell number | embryonic stage 12, with C1GalTA^GD1019

(Valoskova et al., 2019)

abnormal cell number | embryonic stage 12, with Qsox1^KK101108

(Valoskova et al., 2019)

abnormal cell number | embryonic stage, with kay^Fbz.UAS

(Belyaeva et al., 2022)

abnormal cell number | embryonic stage, with kay^HMS00254

(Belyaeva et al., 2022)

abnormal cell number | embryonic stage, with kay^JF02804

(Belyaeva et al., 2022)

abnormal cell polarity, with spas^UAS.cTa

(Stramer et al., 2010)

abnormal wound healing | embryonic stage, with Pez^HMS00861, Scer\GAL4^crq.PA

(Campbell et al., 2021)

abnormal wound healing | embryonic stage, with Pez^HMS00862, Scer\GAL4^crq.PA

(Campbell et al., 2021)

decreased cell number | embryonic stage 12, with C1GalTA^KK101417

(Valoskova et al., 2019)

decreased cell number | embryonic stage 12, with mrva^KK103883

(Valoskova et al., 2019)

decreased cell number | embryonic stage, with CG9331^GD14190

(Emtenani et al., 2022)

decreased cell number | embryonic stage, with CG9331^HMC05687

(Emtenani et al., 2022)

decreased cell number | embryonic stage, with CG9331^KK113180

(Emtenani et al., 2022)

decreased cell number | embryonic stage, with cher^KK107518

(Belyaeva et al., 2022)

decreased cell number | embryonic stage, with dia^HM05027

(Belyaeva et al., 2022)

decreased cell number | embryonic stage, with dia^HMS00308

(Belyaeva et al., 2022)

decreased cell number | embryonic stage, with LKRSDH^GD5241

(Emtenani et al., 2022)

decreased cell number | embryonic stage, with LKRSDH^KK102032

(Emtenani et al., 2022)

decreased cell number | embryonic stage, with pths^GD14168

(Emtenani et al., 2022)

decreased cell number | embryonic stage, with TM4SF^KK111096

(Belyaeva et al., 2022)

decreased cell size | embryonic stage, with kay^Fbz.UAS

(Belyaeva et al., 2022)

lethal, with Pvr^{ΔC.UAS.Tag:SS(hEFNB1),Tag:HA}

(Bruckner et al., 2004)

lethal - all die before end of pupal stage, with Rac1^V12.UAS

(Ninov et al., 2007)

some die during pupal stage, with Rac1^V12.UAS

(Ninov et al., 2007)

viable, with Pvr^{λ.UASp.Tag:MYC}

(Bruckner et al., 2004)

Phenotype Manifest In

cytoskeleton, with spas^UAS.cTa

(Stramer et al., 2010)

embryonic/larval hemocyte, with hid^Ala5.UAS

(Bruckner et al., 2004, Bruckner et al., 2004)

embryonic/larval hemocyte, with Itgbn^NIG.1762R

(Nonaka et al., 2013)

embryonic/larval hemocyte, with Pvr^{ΔC.UAS.Tag:SS(hEFNB1),Tag:HA}

(Bruckner et al., 2004)

embryonic/larval hemocyte, with Pvr^{λ.UASp.Tag:MYC}

(Bruckner et al., 2004)

embryonic/larval hemocyte, with Ras85D^N17.UAS

(Bruckner et al., 2004)

embryonic/larval hemocyte, with scb^NIG.8095R

(Nonaka et al., 2013)

embryonic/larval hemocyte | third instar larval stage, with Rho1^N19.UAS

(Bausek and Zeidler, 2014)

embryonic/larval hemocyte | third instar larval stage, with Rho1^V14.UAS

(Bausek and Zeidler, 2014)

embryonic/larval plasmatocyte | decreased number | embryonic stage, with CG9331^KK113180

(Emtenani et al., 2022)

embryonic/larval plasmatocyte | decreased number | embryonic stage, with cher^KK107518

(Belyaeva et al., 2022)

embryonic/larval plasmatocyte | decreased number | embryonic stage, with dia^HM05027

(Belyaeva et al., 2022)

embryonic/larval plasmatocyte | decreased number | embryonic stage, with dia^HMS00308

(Belyaeva et al., 2022)

embryonic/larval plasmatocyte | decreased number | embryonic stage, with TM4SF^KK111096

(Belyaeva et al., 2022)

embryonic/larval plasmatocyte | embryonic stage 12, with C1GalTA^GD1019

(Valoskova et al., 2019)

embryonic/larval plasmatocyte | embryonic stage 12, with C1GalTA^KK101417

(Valoskova et al., 2019)

embryonic/larval plasmatocyte | embryonic stage 12, with mrva^KK103883

(Valoskova et al., 2019)

embryonic/larval plasmatocyte | embryonic stage 12, with Qsox1^KK101108

(Valoskova et al., 2019)

embryonic/larval plasmatocyte | embryonic stage, with atos^GD14092

(Emtenani et al., 2022)

embryonic/larval plasmatocyte | embryonic stage, with atos^HMS00234

(Emtenani et al., 2022)

embryonic/larval plasmatocyte | embryonic stage, with atos^KK100508

(Emtenani et al., 2022)

embryonic/larval plasmatocyte | embryonic stage, with blw^GD11030

(Emtenani et al., 2022)

embryonic/larval plasmatocyte | embryonic stage, with CG9331^GD14190

(Emtenani et al., 2022)

embryonic/larval plasmatocyte | embryonic stage, with CG9331^HMC05687

(Emtenani et al., 2022)

embryonic/larval plasmatocyte | embryonic stage, with Cyt-c1^KK108213

(Emtenani et al., 2022)

embryonic/larval plasmatocyte | embryonic stage, with kay^Fbz.UAS

(Belyaeva et al., 2022)

embryonic/larval plasmatocyte | embryonic stage, with kay^HMS00254

(Belyaeva et al., 2022)

embryonic/larval plasmatocyte | embryonic stage, with kay^JF02804

(Belyaeva et al., 2022)

embryonic/larval plasmatocyte | embryonic stage, with LKRSDH^GD5241

(Emtenani et al., 2022)

embryonic/larval plasmatocyte | embryonic stage, with LKRSDH^KK102032

(Emtenani et al., 2022)

embryonic/larval plasmatocyte | embryonic stage, with pths^GD14168

(Emtenani et al., 2022)

embryonic/larval plasmatocyte | embryonic stage, with UQCR-C1^KK108539

(Emtenani et al., 2022)

embryonic/larval plasmatocyte | embryonic stage, with UQCR-C2^KK108812

(Emtenani et al., 2022)

embryonic anterior Malpighian tubule, with Scer\GAL4^crq.PO, vkg^KK111668

(Bunt et al., 2010)

filamentous actin | embryonic stage, with cher^KK107518

(Belyaeva et al., 2022)

filamentous actin | embryonic stage, with kay^Fbz.UAS

(Belyaeva et al., 2022)

filamentous actin | embryonic stage, with TM4SF^KK111096

(Belyaeva et al., 2022)

filopodium, with Rho1^N19.UAS

(Bausek and Zeidler, 2014)

filopodium, with Rho1^V14.UAS

(Bausek and Zeidler, 2014)

germ band, with atos^GD14092

(Emtenani et al., 2022)

germ band, with atos^HMS00234

(Emtenani et al., 2022)

germ band, with atos^KK100508

(Emtenani et al., 2022)

germ band, with blw^GD11030

(Emtenani et al., 2022)

germ band, with CG9331^GD14190

(Emtenani et al., 2022)

germ band, with CG9331^HMC05687

(Emtenani et al., 2022)

germ band, with CG9331^KK113180

(Emtenani et al., 2022)

germ band, with cher^KK107518

(Belyaeva et al., 2022)

germ band, with Cyt-c1^KK108213

(Emtenani et al., 2022)

germ band, with dia^HM05027

(Belyaeva et al., 2022)

germ band, with dia^HMS00308

(Belyaeva et al., 2022)

germ band, with kay^Fbz.UAS

(Belyaeva et al., 2022)

germ band, with kay^HMS00254

(Belyaeva et al., 2022)

germ band, with kay^JF02804

(Belyaeva et al., 2022)

germ band, with LKRSDH^GD5241

(Emtenani et al., 2022)

germ band, with LKRSDH^KK102032

(Emtenani et al., 2022)

germ band, with pths^GD14168

(Emtenani et al., 2022)

germ band, with TM4SF^KK111096

(Belyaeva et al., 2022)

germ band, with UQCR-C1^KK108539

(Emtenani et al., 2022)

germ band, with UQCR-C2^KK108812

(Emtenani et al., 2022)

germ band | embryonic stage 12, with C1GalTA^GD1019

(Valoskova et al., 2019)

germ band | embryonic stage 12, with C1GalTA^KK101417

(Valoskova et al., 2019)

germ band | embryonic stage 12, with mrva^KK103883

(Valoskova et al., 2019)

germ band | embryonic stage 12, with Qsox1^KK101108

(Valoskova et al., 2019)

hemocyte, with Rac1^V12.UAS

(Ninov et al., 2007)

hemocyte, with spas^UAS.cTa

(Stramer et al., 2010)

hemocyte | late embryonic stage, with sty^UAS.C.Tag:HA

(Bruckner et al., 2004)

larval ventral nerve cord | embryonic stage, with Rcom\RT^A.UAS

(Martinek et al., 2008)

microtubule, with spas^UAS.cTa

(Stramer et al., 2010)

yolk, with atos^GD14092

(Emtenani et al., 2022)

yolk, with atos^HMS00234

(Emtenani et al., 2022)

yolk, with atos^KK100508

(Emtenani et al., 2022)

yolk, with blw^GD11030

(Emtenani et al., 2022)

yolk, with CG9331^GD14190

(Emtenani et al., 2022)

yolk, with CG9331^HMC05687

(Emtenani et al., 2022)

yolk, with LKRSDH^GD5241

(Emtenani et al., 2022)

yolk, with LKRSDH^KK102032

(Emtenani et al., 2022)

yolk, with pths^GD14168

(Emtenani et al., 2022)

yolk, with UQCR-C1^KK108539

(Emtenani et al., 2022)

yolk, with UQCR-C2^KK108812

(Emtenani et al., 2022)

yolk | embryonic stage 12, with C1GalTA^GD1019

(Valoskova et al., 2019)

yolk | embryonic stage 12, with GlcAT-P^MI05251

(Valoskova et al., 2019)

yolk | embryonic stage 12, with Qsox1^KK101108

(Valoskova et al., 2019)

Detailed Description

Statement

Reference

External Data

Linkouts

Interactions

Show genetic interaction network for Enhancers & Suppressors

Phenotypic Class

Enhanced by

Statement

Reference

Scer\GAL4^srp.Hemo, TM4SF^KK111096 has decreased cell number | embryonic stage phenotype, enhanceable by cher^KK107518/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

NOT Enhanced by

Statement

Reference

Scer\GAL4^srp.Hemo, cher^KK107518 has decreased cell number | embryonic stage phenotype, non-enhanceable by TM4SF^KK111096/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has abnormal cell number | embryonic stage phenotype, non-enhanceable by cher^UAS.Tag:FLAG/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Suppressed by

Statement

Reference

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has abnormal cell number | embryonic stage phenotype, suppressible by dia^{ΔDad.UASp.EGFP}/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has abnormal cell number | embryonic stage phenotype, suppressible by dia^HMS00308/Lam^GD1478, Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has abnormal cell number | embryonic stage phenotype, suppressible by LamC^JF01406/dia^HMS00308, Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has abnormal cell number | embryonic stage phenotype, suppressible by dia^HMS00308/Lam^KK102399, Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has abnormal cell number | embryonic stage phenotype, suppressible by TM4SF^UAS.cBa/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has abnormal cell migration | embryonic stage phenotype, suppressible by pths^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has abnormal cell migration | embryonic stage phenotype, suppressible | partially by pths^{Δnls.UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, pths^GD14168 has abnormal cell migration | embryonic stage phenotype, suppressible by Nprl2^GD4298, Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, pths^GD14168 has abnormal cell migration | embryonic stage phenotype, suppressible by Iml1^GD7476, Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, pths^GD14168 has abnormal cell migration | embryonic stage phenotype, suppressible by Tsc1^JF01484/Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has abnormal cell migration | embryonic stage phenotype, suppressible by Nprl2^GD4298, Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has abnormal cell migration | embryonic stage phenotype, suppressible by Tsc1^JF01484/Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has abnormal cell migration | embryonic stage phenotype, suppressible by Iml1^GD7476, Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

NOT suppressed by

Statement

Reference

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has abnormal cell number | embryonic stage phenotype, non-suppressible by cher^UAS.Tag:FLAG/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, cher^KK107518 has decreased cell number | embryonic stage phenotype, non-suppressible by TM4SF^KK111096/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Enhancer of

Statement

Reference

gcm^JF01075/Scer\GAL4^srp.Hemo is an enhancer of melanotic mass phenotype | larval stage | dominant phenotype of Tl^10b

(Bazzi et al., 2023)

cher^KK107518/Scer\GAL4^srp.Hemo is an enhancer of decreased cell number | embryonic stage phenotype of Scer\GAL4^srp.Hemo, TM4SF^KK111096

(Belyaeva et al., 2022)

NOT Enhancer of

Statement

Reference

TM4SF^KK111096/Scer\GAL4^srp.Hemo is a non-enhancer of decreased cell number | embryonic stage phenotype of Scer\GAL4^srp.Hemo, cher^KK107518

(Belyaeva et al., 2022)

cher^UAS.Tag:FLAG/Scer\GAL4^srp.Hemo is a non-enhancer of abnormal cell number | embryonic stage phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

Suppressor of

Statement

Reference

dia^{ΔDad.UASp.EGFP}/Scer\GAL4^srp.Hemo is a suppressor of decreased cell number | embryonic stage phenotype of kay¹

(Belyaeva et al., 2022)

dia^{ΔDad.UASp.EGFP}/Scer\GAL4^srp.Hemo is a suppressor of decreased cell number | embryonic stage phenotype of kay²

(Belyaeva et al., 2022)

dia^{ΔDad.UASp.EGFP}/Scer\GAL4^srp.Hemo is a suppressor of abnormal cell number | embryonic stage phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

dia^HMS00308/Lam^GD1478, Scer\GAL4^srp.Hemo is a suppressor of abnormal cell number | embryonic stage phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

LamC^JF01406/dia^HMS00308, Scer\GAL4^srp.Hemo is a suppressor of abnormal cell number | embryonic stage phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

dia^HMS00308/Lam^KK102399, Scer\GAL4^srp.Hemo is a suppressor of abnormal cell number | embryonic stage phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

TM4SF^UAS.cBa/Scer\GAL4^srp.Hemo is a suppressor of abnormal cell number | embryonic stage phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

Iml1^GD7476, Scer\GAL4^srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

pths^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

pths^{Δnls.UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor | partially of abnormal cell migration | embryonic stage phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

Nprl2^GD4298, Scer\GAL4^srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of Scer\GAL4^srp.Hemo, pths^GD14168

(Emtenani et al., 2022)

Iml1^GD7476, Scer\GAL4^srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of Scer\GAL4^srp.Hemo, pths^GD14168

(Emtenani et al., 2022)

Tsc1^JF01484/Scer\GAL4^srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of Scer\GAL4^srp.Hemo, pths^GD14168

(Emtenani et al., 2022)

pths^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of atos^BG02278

(Emtenani et al., 2022)

CG9331^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of atos^BG02278

(Emtenani et al., 2022)

LKRSDH^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor | partially of abnormal cell migration | embryonic stage phenotype of atos^BG02278

(Emtenani et al., 2022)

Nprl2^GD4298, Scer\GAL4^srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

Tsc1^JF01484/Scer\GAL4^srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo/BacA\p35^UAS.cHa is a suppressor of increased cell death | recessive phenotype of Pvr¹

(Bruckner et al., 2004)

NOT Suppressor of

Statement

Reference

cher^UAS.Tag:FLAG/Scer\GAL4^srp.Hemo is a non-suppressor of abnormal cell number | embryonic stage phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

TM4SF^KK111096/Scer\GAL4^srp.Hemo is a non-suppressor of decreased cell number | embryonic stage phenotype of Scer\GAL4^srp.Hemo, cher^KK107518

(Belyaeva et al., 2022)

Phenotype Manifest In

Enhanced by

Statement

Reference

Scer\GAL4^srp.Hemo, TM4SF^KK111096 has embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype, enhanceable by cher^KK107518/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, TM4SF^KK111096 has germ band phenotype, enhanceable by cher^KK107518/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

NOT Enhanced by

Statement

Reference

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has embryonic/larval plasmatocyte | embryonic stage phenotype, non-enhanceable by cher^UAS.Tag:FLAG/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, cher^KK107518 has embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype, non-enhanceable by TM4SF^KK111096/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, cher^KK107518 has germ band phenotype, non-enhanceable by TM4SF^KK111096/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has germ band phenotype, non-enhanceable by cher^UAS.Tag:FLAG/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Suppressed by

Statement

Reference

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by dia^{ΔDad.UASp.EGFP}/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has germ band phenotype, suppressible by dia^{ΔDad.UASp.EGFP}/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by dia^HMS00308/Lam^GD1478, Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by dia^HMS00308/Lam^KK102399, Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by LamC^JF01406/dia^HMS00308, Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by TM4SF^UAS.cBa/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has germ band phenotype, suppressible by TM4SF^UAS.cBa/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has germ band phenotype, suppressible by dia^HMS00308/Lam^GD1478, Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has germ band phenotype, suppressible by dia^HMS00308/Lam^KK102399, Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has germ band phenotype, suppressible by LamC^JF01406/dia^HMS00308, Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, pths^GD14168 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by Nprl2^GD4298, Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, pths^GD14168 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by Tsc1^JF01484/Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, pths^GD14168 has germ band phenotype, suppressible by Tsc1^JF01484/Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, pths^GD14168 has germ band phenotype, suppressible by Nprl2^GD4298, Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, pths^GD14168 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by Iml1^GD7476, Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, pths^GD14168 has germ band phenotype, suppressible by Iml1^GD7476, Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by Nprl2^GD4298, Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by Iml1^GD7476, Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by Tsc1^JF01484/Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has germ band phenotype, suppressible by Nprl2^GD4298, Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has germ band phenotype, suppressible by Tsc1^JF01484/Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has germ band phenotype, suppressible by Iml1^GD7476, Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by pths^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has germ band phenotype, suppressible by pths^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible | partially by pths^{Δnls.UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

Scer\GAL4^srp.Hemo, atos^GD14092 has germ band phenotype, suppressible | partially by pths^{Δnls.UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo

(Emtenani et al., 2022)

NOT suppressed by

Statement

Reference

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has embryonic/larval plasmatocyte | embryonic stage phenotype, non-suppressible by cher^UAS.Tag:FLAG/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, cher^KK107518 has germ band phenotype, non-suppressible by TM4SF^KK111096/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, kay^Fbz.UAS has germ band phenotype, non-suppressible by cher^UAS.Tag:FLAG/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Scer\GAL4^srp.Hemo, cher^KK107518 has embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype, non-suppressible by TM4SF^KK111096/Scer\GAL4^srp.Hemo

(Belyaeva et al., 2022)

Enhancer of

Statement

Reference

cher^KK107518/Scer\GAL4^srp.Hemo is an enhancer of embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype of Scer\GAL4^srp.Hemo, TM4SF^KK111096

(Belyaeva et al., 2022)

cher^KK107518/Scer\GAL4^srp.Hemo is an enhancer of germ band phenotype of Scer\GAL4^srp.Hemo, TM4SF^KK111096

(Belyaeva et al., 2022)

NOT Enhancer of

Statement

Reference

cher^UAS.Tag:FLAG/Scer\GAL4^srp.Hemo is a non-enhancer of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

TM4SF^KK111096/Scer\GAL4^srp.Hemo is a non-enhancer of embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype of Scer\GAL4^srp.Hemo, cher^KK107518

(Belyaeva et al., 2022)

TM4SF^KK111096/Scer\GAL4^srp.Hemo is a non-enhancer of germ band phenotype of Scer\GAL4^srp.Hemo, cher^KK107518

(Belyaeva et al., 2022)

cher^UAS.Tag:FLAG/Scer\GAL4^srp.Hemo is a non-enhancer of germ band phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

Suppressor of

Statement

Reference

dia^{ΔDad.UASp.EGFP}/Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype of kay¹

(Belyaeva et al., 2022)

dia^{ΔDad.UASp.EGFP}/Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of kay¹

(Belyaeva et al., 2022)

dia^{ΔDad.UASp.EGFP}/Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype of kay²

(Belyaeva et al., 2022)

dia^{ΔDad.UASp.EGFP}/Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of kay²

(Belyaeva et al., 2022)

dia^{ΔDad.UASp.EGFP}/Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

dia^{ΔDad.UASp.EGFP}/Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

dia^HMS00308/Lam^GD1478, Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

dia^HMS00308/Lam^KK102399, Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

LamC^JF01406/dia^HMS00308, Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

TM4SF^UAS.cBa/Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

TM4SF^UAS.cBa/Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

dia^HMS00308/Lam^GD1478, Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

dia^HMS00308/Lam^KK102399, Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

LamC^JF01406/dia^HMS00308, Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

Nprl2^GD4298, Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, pths^GD14168

(Emtenani et al., 2022)

Tsc1^JF01484/Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, pths^GD14168

(Emtenani et al., 2022)

Tsc1^JF01484/Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4^srp.Hemo, pths^GD14168

(Emtenani et al., 2022)

Nprl2^GD4298, Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4^srp.Hemo, pths^GD14168

(Emtenani et al., 2022)

Iml1^GD7476, Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, pths^GD14168

(Emtenani et al., 2022)

Iml1^GD7476, Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4^srp.Hemo, pths^GD14168

(Emtenani et al., 2022)

pths^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of atos^BG02278

(Emtenani et al., 2022)

pths^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of atos^BG02278

(Emtenani et al., 2022)

LKRSDH^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor | partially of embryonic/larval plasmatocyte | embryonic stage phenotype of atos^BG02278

(Emtenani et al., 2022)

CG9331^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of atos^BG02278

(Emtenani et al., 2022)

LKRSDH^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor | partially of germ band phenotype of atos^BG02278

(Emtenani et al., 2022)

CG9331^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of atos^BG02278

(Emtenani et al., 2022)

Nprl2^GD4298, Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

Iml1^GD7476, Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

Tsc1^JF01484/Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

Nprl2^GD4298, Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

Tsc1^JF01484/Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

Iml1^GD7476, Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

pths^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

pths^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

pths^{Δnls.UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor | partially of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

pths^{Δnls.UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo is a suppressor | partially of germ band phenotype of Scer\GAL4^srp.Hemo, atos^GD14092

(Emtenani et al., 2022)

dl^UASp.cMa, Scer\GAL4^srp.Hemo, dl¹ is a suppressor of hemocyte phenotype of Dif¹

(Matova and Anderson, 2006)

dl^UASp.cMa, Scer\GAL4^srp.Hemo, dl¹ is a suppressor of hemolymph phenotype of Dif¹

(Matova and Anderson, 2006)

Scer\GAL4^srp.Hemo/BacA\p35^UAS.cHa is a suppressor of embryonic/larval hemocyte phenotype of Pvr¹

(Wood et al., 2006)

Ras85D^V12.UAS/Scer\GAL4^srp.Hemo is a suppressor | partially of embryonic/larval plasmatocyte | embryonic stage phenotype of Pvr¹

(Bruckner et al., 2004)

Scer\GAL4^srp.Hemo/Pi3K92E^{UAS.Tag:MYC,Tag:PM(hKRAS)} is a suppressor | partially of embryonic/larval hemocyte phenotype of Pvr¹

(Bruckner et al., 2004)

Scer\GAL4^srp.Hemo/BacA\p35^UAS.cHa is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Pvr¹

(Bruckner et al., 2004)

Scer\GAL4^srp.Hemo/BacA\p35^UAS.cHa is a suppressor | partially of embryonic/larval hemocyte phenotype of Pvr¹

(Bruckner et al., 2004)

NOT Suppressor of

Statement

Reference

cher^UAS.Tag:FLAG/Scer\GAL4^srp.Hemo is a non-suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

TM4SF^KK111096/Scer\GAL4^srp.Hemo is a non-suppressor of germ band phenotype of Scer\GAL4^srp.Hemo, cher^KK107518

(Belyaeva et al., 2022)

cher^UAS.Tag:FLAG/Scer\GAL4^srp.Hemo is a non-suppressor of germ band phenotype of Scer\GAL4^srp.Hemo, kay^Fbz.UAS

(Belyaeva et al., 2022)

TM4SF^KK111096/Scer\GAL4^srp.Hemo is a non-suppressor of embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype of Scer\GAL4^srp.Hemo, cher^KK107518

(Belyaeva et al., 2022)

Additional Comments

Genetic Interactions

Statement

Reference

Xenogenetic Interactions

Statement

Reference

Complementation and Rescue Data

Rescues

Scer\GAL4^srp.Hemo/kay^UAS.cEa rescues kay²

(Belyaeva et al., 2022)

atos^{UAS.Tag:FLAG,Tag:HA}/Scer\GAL4^srp.Hemo rescues atos^BG02278

(Emtenani et al., 2022)

Scer\GAL4^crq.PA, Pez^ΔPTP.UAS, Scer\GAL4^srp.Hemo rescues Pez²

(Campbell et al., 2021)

Scer\GAL4^crq.PA, Pez^PD.UAS, Scer\GAL4^srp.Hemo rescues Pez²

(Campbell et al., 2021)

Scer\GAL4^crq.PA, Pez^UAS.cPa, Scer\GAL4^srp.Hemo rescues Pez²

(Campbell et al., 2021)

Scer\GAL4^crq.PA, Pez^UAS.sfGFP, Scer\GAL4^srp.Hemo rescues Pez²

(Campbell et al., 2021)

Scer\GAL4^srp.Hemo/mrva^{UAS.Tag:FLAG,Tag:HA} rescues mrva^EP3102

(Valoskova et al., 2019)

C1GalTA^UAS.cFa/Scer\GAL4^srp.Hemo rescues C1GalTA^EY13370

(Fuwa et al., 2015)

drpr^UAS.cFa/Scer\GAL4^srp.Hemo rescues drpr^Δ5

(Fujita et al., 2012)

Scer\GAL4^srp.Hemo/drpr^Y949F.UAS rescues drpr^Δ5

(Fujita et al., 2012)

Vps16B^UAS.Tag:MYC/Scer\GAL4^srp.Hemo rescues Vps16B¹

(Akbar et al., 2011)

Itgbn^UAS.cNa/Scer\GAL4^srp.Hemo rescues Itgbn²

(Nagaosa et al., 2011)

chb^UAS.GFP/Scer\GAL4^srp.Hemo rescues chb²

(Stramer et al., 2010)

sn^UASp.EGFP/Scer\GAL4^srp.Hemo rescues Df(1)C128

(Zanet et al., 2009)

sn^{S52A.UASp.EGFP}/Scer\GAL4^srp.Hemo rescues Df(1)C128

(Zanet et al., 2009)

sn^{S52D.UASp.EGFP}/Scer\GAL4^srp.Hemo rescues Df(1)C128

(Zanet et al., 2009)

sn^{S52E.UASp.EGFP}/Scer\GAL4^srp.Hemo rescues Df(1)C128

(Zanet et al., 2009)

Partially rescues

sn^UASp.cZa/Scer\GAL4^srp.Hemo partially rescues Df(1)C128

(Zanet et al., 2009)

sn^UASp.EGFP/Scer\GAL4^srp.Hemo partially rescues sn^X2

(Zanet et al., 2009)

sn^{S52A.UASp.EGFP}/Scer\GAL4^srp.Hemo partially rescues sn^X2

(Zanet et al., 2009)

sn^{S52E.UASp.EGFP}/Scer\GAL4^srp.Hemo partially rescues sn^X2

(Zanet et al., 2009)

Pvr^{λ.UASp.Tag:MYC}/Scer\GAL4^srp.Hemo partially rescues Pvr¹

(Bruckner et al., 2004)

Fails to rescue

Scer\GAL4^crq.PA, Pez^ΔFERM.UAS, Scer\GAL4^srp.Hemo fails to rescue Pez²

(Campbell et al., 2021)

Scer\GAL4^srp.Hemo/drpr^Y858F.UAS fails to rescue drpr^Δ5

(Fujita et al., 2012)

prtp^UAS.cKa/Scer\GAL4^srp.Hemo fails to rescue prtp^Δ1

(Kuraishi et al., 2009)

Comments

Images (0)

Mutant

Wild-type

Stocks (1)

Bloomington

78565

y¹ w^*; P{srp.Hemo-GAL4}2, P{UAS-GFP.U}3

Notes on Origin

Discoverer

External Crossreferences and Linkouts ( 0 )

Synonyms and Secondary IDs (1)

Reported As

Symbol Synonym

Scer\GAL4^srp.Hemo

Name Synonyms

Secondary FlyBase IDs

References (53)

Report Sections

Open Close