24bp deletion plus 23bp insertion within prominin-like. This results in a frameshift and a stop codon in the first exon.
24 bases in the first coding exon of promL are deleted and replaced with 23 bases causing a frameshift and leading to early translation termination.
GGGCCGGTTGCAGATCGCGGGAG
abnormal size | adult stage (with promLΔ)
increased body size | P-stage (with promLΔ)
visible | adult stage (with promLΔ)
visible | larval stage (with promLΔ)
lipid droplet | adult stage (with promLΔ)
In promLA3-1 larvae, the wing disc pouch is small, and microvilli are absent or severely shortened/misshapen.
In promLΔ/promLA3-1 adults the body weight is significantly increased, the average daytime locomotor activity is decreased and the size of the mushroom body calyx (FAS II) is decreased while during development there is no alteration in neuroblast asymmetric division (Miranda) at third instar larval stage or in the developmental timing when compared to controls.
promLΔ/promLA3-1 animals, on a normal diet, exhibit a significant increase in body size at pupal and adult stages; they exhibit an increase in lipid droplet size in the adult abdominal fat body, but not on the third instar larval fat body when compared to controls.
In promLΔ/promLA3-1 animals on the low protein diet the pupation rate is significantly greater, the eclosion time is significantly shorter, the adult body is significantly heavier and both larvae and prepupae are larger than controls.
promLΔ/promLA3-1 has increased body size | pupal stage phenotype, suppressible by Scer\GAL4Cg.PU/Hsap\PROM1UAS.cZa
promLΔ/promLA3-1 has visible | P-stage phenotype, suppressible by Scer\GAL4Cg.PU/Hsap\PROM1UAS.cZa
promLΔ/promLA3-1 is a suppressor | partially of decreased body size | male | pupal stage phenotype of Hsap\PROM1UAS.cZa, Scer\GAL4Cg.PU
promLΔ/promLA3-1 is a suppressor of decreased body size | female | pupal stage phenotype of Hsap\PROM1UAS.cZa, Scer\GAL4Cg.PU
promLΔ/promLA3-1 is a suppressor | partially of visible | male | pupal stage phenotype of Hsap\PROM1UAS.cZa, Scer\GAL4Cg.PU
promLΔ/promLA3-1 is a suppressor of visible | female | pupal stage phenotype of Hsap\PROM1UAS.cZa, Scer\GAL4Cg.PU
promLΔ/promLA3-1 is rescued by promLUAS.CTAP/Scer\GAL4Tub.PU
promLΔ/promLA3-1 is rescued by promLUAS.CTAP/Scer\GAL4Cg.PU
promLΔ/promLA3-1 rescues promLUAS.CTAP