Imprecise excision of the progenitor insertion has resulted in a 679bp deletion that extends from the middle of the first Marcal1 exon into the second intron.
679 bp deletion from R5:2L:4956255..4956933 resulting from the imprecise excision of P{SUPor-P}Marcal1KG09850, which extends from the end of the first exon to the second intron. There is also a 35 bp insertion (ATGATGAAATAACATCATTATATCGATTAACACAG) at the site.
ATGATGAAATAACATCATTATATCGATTAACACAG
Marcal1del/Marcal1kh1 transheterozygous mutants show defects in the DNA double-strand break repair as assessed by the P{hswa} and P{wIw.FRT} male germline assay: the mutants display significantly reduced synthesis-dependent strand annealing (SDSA) repair (both in percentage of total progeny scored and in number of males with observable SDSA events in the progeny) as well as reduced single-strand annealing (SSA) capacity relative to wild-type controls.
Homozygous flies have no morphological differences to wild type and have a normal lifespan at 20[o]C.
Homozygotes are significantly less viable than wild type at 25[o]C (less than 75% viability) and at 30[o]C (less than 20% viability). The eggs laid by homozygous flies are smaller than normal at 25[o]C but not at 20[o]C.
Marcal1del/Marcal1del is an enhancer of visible | adult stage phenotype of Scer\GAL4ey.PU, brmK804R.UAS.Tag:HA
Marcal1del/Marcal1del is an enhancer of abnormal size | adult stage phenotype of Scer\GAL4ey.PU, brmK804R.UAS.Tag:HA
Marcal1del/Marcal1kh1 is a non-enhancer of abnormal DNA repair | adult stage phenotype of Brca247
Marcal1del/Marcal1del is a suppressor | partially of homeotic phenotype of Pc1, ph-p[+]/ph-p410
Marcal1[+]/Marcal1del is a suppressor of homeotic phenotype of ph-p410
Marcal1del/Marcal1del is a suppressor of homeotic phenotype of ph-p410
Marcal1[+]/Marcal1del is a suppressor of homeotic phenotype of Pc1
Marcal1del/Marcal1del is a suppressor of homeotic phenotype of Pc1
Marcal1[+]/Marcal1del is a suppressor of homeotic phenotype of Psc1
Marcal1[+]/Marcal1del is a suppressor of homeotic phenotype of ScmD1
Marcal1del/Marcal1kh1 is a non-suppressor of abnormal DNA repair | adult stage phenotype of Brca247
Marcal1del, Psc1 has lethal phenotype
Marcal1del, ScmD1 has lethal phenotype
Marcal1del, RpII215[+]/Polr2A4 has partially lethal - majority die | embryonic stage phenotype
Marcal1del, RpII215[+]/Polr2A3 has partially lethal - majority die | embryonic stage phenotype
Marcal1del, RpII215[+]/Polr2A8 has partially lethal - majority die | embryonic stage phenotype
Marcal1del, Polr2AK1/RpII215[+] has partially lethal - majority die | embryonic stage phenotype
Marcal1del/Marcal1del is an enhancer of eye phenotype of Scer\GAL4ey.PU, brmK804R.UAS.Tag:HA
Marcal1[+]/Marcal1del is a suppressor of sex comb phenotype of ScmD1
Marcal1[+]/Marcal1del is a suppressor of sex comb phenotype of ph-p410
Marcal1del/Marcal1del is a suppressor of sex comb phenotype of ph-p410
Marcal1del/Marcal1del is a suppressor | partially of wing phenotype of Pc1, ph-p[+]/ph-p410
Marcal1[+]/Marcal1del is a suppressor of sex comb phenotype of Pc1
Marcal1del/Marcal1del is a suppressor of sex comb phenotype of Pc1
Marcal1[+]/Marcal1del is a suppressor of sex comb phenotype of Psc1
Marcal1del, RpII215[+]/Polr2A4 has egg phenotype
The defects in the DNA double-strand break repair (no synthesis-dependent strand annealing repair events and a compensatory increase in the percentage of end joining repair events) as assessed by the P{hswa} male germline assay characteristic for Brca247 are not modified by combination with Marcal1del/Marcal1kh1 alleles.
The homeotic transformation of the mesothoracic legs into prothoracic legs manifesting as extra sex combs observed in any of the following: ph-p410/Y, Pc1/+, Psc1/+ and ScmD1/+ males is partially suppressed by Marcal1del heterozygosity. In ph-p410/Y or Pc1/+ males combination with Marcal1del in homozygosity leads to a stronger rescue but in Psc1/+ or ScmD1/+ heterozygotes it leads to lethality. Similarly, the partial homeotic wing-to-haltere transformation characteristic for in ph-p410/+;Pc1/+ double heterozygotes is ameliorated by combination with Marcal1del in homozygosity.
The small and rough eye phenotype seen in adult flies expressing brmK804R.Scer\UAS.T:Ivir\HA1 under the control of Scer\GAL4ey.PU is exacerbated further by Marcal1del homozygosity.
Marcal1del/Marcal1del RpII2154/+, Marcal1del/Marcal1del RpII2153/+, Marcal1del/Marcal1del RpII2158/+ and Marcal1del/Marcal1del RpII215K1/+ embryos show a reduced hatching rate compared to controls at 20[o]C.
The eggs laid by Marcal1del/Marcal1del RpII2154/+ are smaller than normal.