Imprecise P-element excision leaving 20bp of the terminal inverted repeat sequence and an additional duplication of genomic sequence to give a total insertion of 48bp.
CATGATCAAATAACATCATGCTACAAGGATTTCAATCATGCTACAAGG
Derivative of plu1 which leaves behind 20 bp of P sequence as well as duplicated host DNA, resulting in 48 bp of extraneous DNA between the indicated bases relative to the reference sequence.
Eggs from homozygous females have pronuclei which appear as abnormally large interphase nuclei.
Homozygous females lay eggs in which the meiotic products and the pronucleus undergo extensive DNA replication resulting in a 'giant nuclei' phenotype. dhdJ5 does not suppress the premature initiation of DNA synthesis in double mutants.
Embryos undergo extensive DNA replication without nuclear division and form a fused giant polyploid nuclei from the male and female pronuclei and from the polar body nuclei.
Transheterozygotes with plu2 are female sterile and embryos produced have a giant polyploid nuclei.
plu[+]/plu3 is a non-suppressor of abnormal mitotic cell cycle | maternal effect | cleavage stage phenotype of hd1/Df(3R)3-4, Scer\GAL4c323, hdUAS.cBa
plu3/plu3 is a non-suppressor of abnormal mitotic cell cycle | maternal effect | cleavage stage phenotype of hd1/Df(3R)3-4, Scer\GAL4c323, hdUAS.cBa
Df(3R)3-4/+, Scer\GAL4c323, hdUAS.cBa, plu3 has abnormal mitotic cell cycle | maternal effect | cleavage stage phenotype
Df(3R)3-4/+, Scer\GAL4c323, hdUAS.cBa, plu3 has abnormal size | maternal effect | cleavage stage phenotype
plu3/plu3 is a non-suppressor of chromosome | maternal effect | cleavage stage phenotype of hd1/Df(3R)3-4, Scer\GAL4c323, hdUAS.cBa
Df(3R)3-4/+, Scer\GAL4c323, hdUAS.cBa, plu3 has nucleus | embryonic stage phenotype
In 94% of eggs derived from Hira185b ; plu3 double homozygous females, the male pronucleus displays a typical Hira mutant phenotype, appearing very small in size and containing condensed chromosomes, whereas the female pronucleus and polar bodies are usually larger than control nuclei in these eggs. In the rest of the mutant eggs, there is limited and heterogeneous decondensation of the paternal chromatin.
Mutant phenotype can be rescued by the plu+t3.8 construct.