Date: Wed, 12 May 2004 15:19:38 -0500 To: rd120XXXX, flybase-updatesXXXX, Annette Parks <annettep@XXXX> From: Kevin Cook <kcook@XXXX> Subject: Psn constructs and insertions The following information was provided by Annette Parks of Exelixis, Inc. In P{UAS-Psn.541.Exel}, the sequence encoding the 541 amino acid isoform of Psn (FBgn0019947) was cloned into P{Express-UAS). P{UAS-Psn.541.Exel}1 is a homozygous and hemizygous viable and fertile, X chromosome insertion. P{UAS-Psn.541.Exel}2 is a homozygous viable and fertile, second chromosome insertion. P{UAS-Psn.541.Exel}3 is a homozygous viable and fertile, third chromosome insertion. In P{UAS-Psn.541.N157I.Exel}, Psn sequences encoding a N157I variant of the 541 amino acid isoform were cloned into P{Express-UAS). The N157I change in flies mimics the N141I change in humans. P{UAS-Psn.541.N157I.Exel}1 is a homozygous and hemizygous viable and fertile, X chromosome insertion. P{UAS-Psn.541.N157I.Exel}3 is a homozygous viable and fertile, third chromosome insertion. FlyBase curator comment: the description below of the nature of the "P{UAS-Psn.541.M157V}" construct is incorrect - please see FBrf0208317 for the correct details of the nature of the construct. Please also note that the construct has subsequently been renamed to "P{UAS-Psn.541.M255V}" to more accurately reflect its composition. In P{UAS-Psn.541.M157V}, Psn sequences encoding a M157V variant of the 541 amino acid isoform were cloned into P{Express-UAS). The M157V change in flies mimics the M239V change in humans. P{UAS-Psn.541.M157V}1 is a homozygous and hemizygous viable and fertile, X chromosome insertion. P{UAS-Psn.541.M157V}2 is a homozygous viable and fertile, second chromosome insertion. P{UAS-Psn.541.M157V}3 is a homozygous viable and fertile, third chromosome insertion. In P{UAS-antisense.Psn.541}, the sequence encoding the 541 amino acid isoform of Psn was cloned into P{Express-UAS) in an antisense direction. P{UAS-antisense.Psn.541}1 is a homozygous and hemizygous viable and fertile, X chromosome insertion. P{UAS-antisense.Psn.541}2 is a homozygous viable and fertile, second chromosome insertion. P{UAS-antisense.Psn.541}3 is a third chromosome insertion. In P{UAS-Psn.527.Exel}, the sequence encoding the 527 amino acid isoform of Psn was cloned into P{Express-UAS). P{UAS-Psn.527.Exel}1 is a homozygous and hemizygous viable and fertile, X chromosome insertion. P{UAS-Psn.527.Exel}2 is a homozygous viable and fertile, second chromosome insertion. P{UAS-Psn.527.Exel}3 is a homozygous viable and fertile, third chromosome insertion. In P{sev-Psn.527.Exel}, the sequence encoding the 527 amino acid isoform of Psn was cloned into either P{Express-sev1x) or P{Express-sev3x}. P{sev-Psn.527.Exel}2 is a homozygous viable and fertile, second chromosome insertion. P{sev-Psn.527.Exel}3 is a homozygous viable and fertile, third chromosome insertion. In P{GMR-Psn.527.Exel}, the sequence encoding the 527 amino acid isoform of Psn was cloned into P{Express-glass). P{GMR-Psn.527.Exel}2 is a second chromosome insertion. P{GMR-Psn.527.Exel}3 is a homozygous viable and fertile, third chromosome insertion. In P{UAS-Psn.527.D447A}, Psn sequences encoding a D447A variant of the 527 amino acid isoform were cloned into P{Express-UAS). The D447A change in flies mimics the D385A change in humans. P{UAS-Psn.527.D447A}1 is a homozygous and hemizygous viable and fertile, X chromosome insertion. P{UAS-Psn.527.D447A}2 is a homozygous viable and fertile, second chromosome insertion. P{UAS-Psn.527.D447A}3 is a homozygous viable and fertile, third chromosome insertion. In P{GMR-Psn.527.D447A}, Psn sequences encoding a D447A variant of the 527 amino acid isoform were cloned into P{Express-glass). The D447A change in flies mimics the D385A change in humans. P{GMR-Psn.527.D447A}1 is a homozygous and hemizygous viable and fertile, X chromosome insertion. P{GMR-Psn.527.D447A}2 is a homozygous viable and fertile, second chromosome insertion. P{GMR-Psn.527.D447A}3 is a homozygous viable and fertile, third chromosome insertion. In P{UAS-Psn.527.deltaE9}, Psn sequences encoding a variant of the 527 amino acid isoform with the equivalent of human exon 9 deleted and replaced with a cys were cloned into P{Express-UAS}, i.e. nucleotides 1078-1170 (TCCACTGTCGTTTACGCACTTGTAAACACTGTTACGCCGCAGCAATCGCAGGCCCAGCTTCCTCCTCGCCGTCGTCCAGCAACTCCACCACA) in AF017024 were replaced with a cys. P{UAS-Psn.527.deltaE9}2 is a homozygous viable and fertile, second chromosome insertion. P{UAS-Psn.527.deltaE9}3 is a homozygous viable and fertile, third chromosome insertion. In P{GMR-Psn.527.deltaE9}, Psn sequences encoding a variant of the 527 amino acid isoform with the equivalent of human exon 9 deleted and replaced with a cys were cloned into P{Express-glass}, i.e. nucleotides 1078-1170 (TCCACTGTCGTTTACGCACTTGTAAACACTGTTACGCCGCAGCAATCGCAGGCCCAGCTTCCTCCTCGCCGTCGTCCAGCAACTCCACCACA) in AF017024 were replaced with a cys. P{GMR-Psn.527.deltaE9}1 is a homozygous and hemizygous viable and fertile, X chromosome insertion. P{GMR-Psn.527.deltaE9}2 is a homozygous viable and fertile, second chromosome insertion. P{GMR-Psn.527.deltaE9}3 is a homozygous viable and fertile, third chromosome insertion. In P{UAS-Psn.527.deltaE9.D447A}, Psn sequences encoding a variant of the 527 amino acid isoform with two alterations cloned into P{Express-UAS}. First, the equivalent of human exon 9 was deleted and replaced with a cys, i.e. nucleotides 1078-1170 (TCCACTGTCGTTTACGCACTTGTAAACACTGTTACGCCGCAGCAATCGCAGGCCCAGCTTCCTCCTCGCCGTCGTCCAGCAACTCCACCACA) in AF017024 were replaced with a cys. Second, a D447A change was introduced to mimic the D385A change in humans. P{UAS-Psn.527.deltaE9.D447A}1 is a homozygous and hemizygous viable and fertile, X chromosome insertion. P{UAS-Psn.527.deltaE9.D447A}2 is a homozygous viable and fertile, second chromosome insertion. P{UAS-Psn.527.deltaE9.D447A}3 is a homozygous viable and fertile, third chromosome insertion. In P{GMR-Psn.527.deltaE9.D447A}, Psn sequences encoding a variant of the 527 amino acid isoform with two alterations were cloned into P{Express-glass}. First, the equivalent of human exon 9 was deleted and replaced with a cys, i.e. nucleotides 1078-1170 (TCCACTGTCGTTTACGCACTTGTAAACACTGTTACGCCGCAGCAATCGCAGGCCCAGCTTCCTCCTCGCCGTCGTCCAGCAACTCCACCACA) in AF017024 were replaced with a cys. Second, a D447A change was introduced to mimic the D385A change in humans. P{GMR-Psn.527.deltaE9.D447A}1 is a homozygous and hemizygous viable and fertile, X chromosome insertion. P{GMR-Psn.527.deltaE9.D447A}2 is a homozygous viable and fertile, second chromosome insertion. In P{GMR-Psn.527.D279A}, Psn sequences encoding a D279A variant of the 527 amino acid isoform were cloned into P{Express-glass). The D279A change in flies mimics the D257A change in humans. P{GMR-Psn.527.D279A}2 is a homozygous viable and fertile, second chromosome insertion. P{GMR-Psn.527.D279A}3 is a homozygous viable and fertile, third chromosome insertion. __________________________________________________________ Kevin Cook, Ph.D. Bloomington Drosophila Stock Center Department of Biology http://flystocks.bio.indiana.edu Jordan Hall 142 Indiana University 812-856-1213 1001 E. Third St. 812-855-2577 (fax) Bloomington, IN 47405-3700 kcook@XXXX
