Deletion affecting Mst27D; starts 42bp upstream of the translation initiation codon and ends 191bp before the stop codon. The sequence across the deletion is TTTCCTTTTAAGACCTGTACTCCTTACCTTAGAATAAACGGCAAGAGTGCATCCGCGTAAAGCGG.
A 1123bp deletion that removes most of Mst27D. The sequence TTAGAAT is inserted at the site of the deletion. The sequence across the deletion is TTTCCTTTTAAGACCTGTACTCCTTACCTTAGAATAAACGGCAAGAGTGCATCCGCGTAAAGCGG.
TTAGAAT