The following information accompanied stocks donated to the Bloomington Stock Center by Christian Lehner, University of Zürich.
Mst27Dcc1-4 is a CRISPR-induced intragenic deletion starting 42 bp upstream of the initiation codon and ending 191 bp before the stop codon. The sequence across the deletion is  TTTCCTTTTAAGACCTGTACTCCTTACCTTAGAATAAACGGCAAGAGTGCATCCGCGTAAAGCGG.
P{Mst27D.mCherry} expresses Mst27D protein with a C-terminal mCherry tag under the control of the Mst27D cis-regulatory region. It was made with a pCaSpeR derivative that includes the SV40 terminator sequence (as in the case of P{Mst27D-EGFP} (FBtp0137336) described in Gärtner et al. (2019; FBrf0242499)) rather than the endogenous Mst27D 3' sequences.
P{Mst27D.mCherry}II.3 is a second chromosome insertion.
P{Mst27D.mCherry}III.1 is a homozygous viable and fertile, third chromosome insertion.
P{Mst27D.Dendra2} expresses Mst27D protein with a C-terminal Dendra2 tag under the control of the Mst27D cis-regulatory region. It was made with a pCaSpeR derivative that includes the SV40 terminator sequence (as in the case of P{Mst27D-EGFP} (FBtp0137336) described in Gärtner et al. (2019; FBrf0242499)) rather than the endogenous Mst27D 3' sequences.
P{Mst27D.Dendra2}II.1 is a second chromosome insertion.
P{Mst27D.Dendra2}III.1 is a third chromosome insertion.
P{Mst27D.EGFP.endo3'} expresses Mst27D protein with a C-terminal EGFP tag under the control of the Mst27D cis-regulatory region. It was made with a pCaSpeR derivative and includes the endogenous Mst27D 3' sequences rather than the SV40 terminator sequences used in the construction of P{Mst27D-EGFP} (FBtp0137336) by Gärtner et al. (2019; FBrf0242499).
P{Mst27D.EGFP.endo3'}III.1 is a third chromosome insertion.