Comment: 0-24 hr AEL
TTAACGATAATATAAGCTGCTCGCTGGTTTTTAAATCGGGCTATGGTGATGGCTTTGGTCTGGGTAACATAACCCAAGTA AATAGC
RT-PCR products amplified with pairs of gene-specific primers from template RNA representing pooled Drosophila stages.
0-24 hr embryo (derived from 4-6 hr subcollections), late third-instar larva (L3), mixed-stage pupa, and mixed-age adult were pooled.
Poly(A)+ RNA was isolated. RT-PCR products were amplified from template RNA using pairs of gene-specific primers.
This collection of ESTs resulted from direct sequencing of RT-PCR products and were not cloned into a vector are therefore unavailable as reagents.