A snRNA:U6:96Ac promoter drives expression of three sgRNAs (GAAGTCCATGTCGGAAATCA, ATCAGGCACCCTGGCCCGTT, and GAAGCCCTCTCACTCCGCAC), each of which targets a different exon of Sarm.
SarmU6:3.sgRNAx3, Scer\GAL4tey-5053A, Spyo\Cas9UAS.P2 is a non-enhancer of abnormal neuroanatomy | larval stage phenotype of Scer\GAL4Toll-6-D42, rawKK104042
SarmU6:3.sgRNAx3, Scer\GAL4tey-5053A, Spyo\Cas9UAS.P2 is a non-suppressor of abnormal neuroanatomy | larval stage phenotype of Scer\GAL4Toll-6-D42, rawKK104042
SarmU6:3.sgRNAx3, Scer\GAL4tey-5053A, Spyo\Cas9UAS.P2 is a non-enhancer of embryonic/larval neuromuscular junction | larval stage phenotype of Scer\GAL4Toll-6-D42, rawKK104042
SarmU6:3.sgRNAx3, Scer\GAL4tey-5053A, Spyo\Cas9UAS.P2 is a non-enhancer of embryonic/larval motor neuron | larval stage phenotype of Scer\GAL4Toll-6-D42, rawKK104042
SarmU6:3.sgRNAx3, Scer\GAL4tey-5053A, Spyo\Cas9UAS.P2 is a non-suppressor of embryonic/larval neuromuscular junction | larval stage phenotype of Scer\GAL4Toll-6-D42, rawKK104042
SarmU6:3.sgRNAx3, Scer\GAL4tey-5053A, Spyo\Cas9UAS.P2 is a non-suppressor of embryonic/larval motor neuron | larval stage phenotype of Scer\GAL4Toll-6-D42, rawKK104042