UASt regulatory sequences drive expression of RpII215 with a truncated C-terminal domain (CTD). The coding sequence is tagged at the C-terminal end with two copies of Tag:FLAG and has been rendered resistant to RNAi by the P{TRiP.GL01068} line by synonymous mutations in the sequence targeted by the P{TRiP.GL01068} shRNA (AACGGTGAAACTGTCGAACAA mutated to AACCGTCAAGTTGAGCAACAA).