construct_comment: P{BigParent} in which Ori66Dβ has been replaced by a short stretch of Scer\ARS1 sequence amplified using primers \'GATCTTATTTATTTAAGTATTGTTTC\' and \'TCGAGAAACAATACTTAAATAAATAA\'.
P{BigParent} in which Ori66Dβ has been replaced by a short stretch of Scer\ARS1 sequence amplified using primers \'GATCTTATTTATTTAAGTATTGTTTC\' and \'TCGAGAAACAATACTTAAATAAATAA\'.
construct_comment: P{BigParent} in which Ori66Dβ has been replaced by a short stretch of Scer\ARS1 sequence amplified using primers \'GATCTTATTTATTTAAGTATTGTTTC\' and \'TCGAGAAACAATACTTAAATAAATAA\'.
P{BigParent} in which Ori66Dβ has been replaced by a short stretch of Scer\ARS1 sequence amplified using primers \'GATCTTATTTATTTAAGTATTGTTTC\' and \'TCGAGAAACAATACTTAAATAAATAA\'.