FB2024_03 , released June 25, 2024
Sequence Feature: Dmel\dsRNA-HMS02171
Open Close
General Information
Symbol
Dmel\dsRNA-HMS02171
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000437512
Collection
Associated gene
Genomic Location
Chromosome (arm)
2R
Sequence location

2R:6,626,040..6,626,060 [-]

Genomic Maps
Sequence Data
Length
21
Comments

A top strand oligo is designed by concatenating "ctagcagt", the sense-strand oligo, "tagttatattcaagcata", the anti-sense oligo, and "gcg". A bottom strand oligo is designed by concatenating "aattcgc", the sense-strand oligo,"tatgcttgaatataacta", the anti-sense oligo, and "actg".

One copy of repeat shown.

TAGACGAATGTTGCAAATGAA
Associated Information
Gene(s) (targeted or local)
Allele(s)
Transcripts(s)
    Polypeptide(s)
      Construct
      Experimental Data
      Progenitors
      PCR template
      Primer 1
      Primer 2
      Comments
      Collection Information
      Collection: TRiP-3
      Symbol
      Title
      A set of transgenic RNAi constructs for expression of shRNA under UAS control, TRiP second generation (pVALIUM20).
      Source and Progenitors
      Species of derivation
      D. melanogaster
      Strain of derivation
      Vector of progenitor construct
      Description

      NOTE: Dataset members correspond to the amplicon sequence features; these can be used to retrieve associated constructs and stocks.

      The TRiP-3 construct collection represents a second generation of TRiP lines. Each construct is designed to target the knockdown of a single gene during oogenesis using short hairpin RNA (shRNA).

      Additional data
      Sample preparation
      Collection preparation

      Transgenic animals were designed to carry a short hairpin RNA (shRNA) under UAS-GAL4 control. To design the shRNA for any given gene, sequence for all exons, or all exon portions common to all transcripts, were reverse complemented and all possible 21-bp subsequences were determined. Sequences with off-target matches of 16-bp or more were discarded. The remaining sequences were scored as per Vert et al., 2006 (PMID: 17137497). Top and bottom strand oligonucleotides for the top scoring sequence were cloned into pVALIUM20, which by virture of it's hsp70 basal promoter, drives excellent knockdown in the soma and works well in the female germline. The hairpin-containing transgenes were inserted via site-specific recombination into genomic loci known to be optimal for expression, either the P{CaryP}attP2 or P{CaryP}attP40 target element.

      shRNA sequences were predicted for all annotated genes, the vast majority using 'designer of small interfering RNA' (DSIR, Vert et al., 2006, PMID: 17137497). To minimize off­target effects, shRNAs whose guide or passenger strands had complementary matches of 16 nucleotides or more to the fly transcriptome. Only shRNAs that lacked sequence complementarity to annotated microRNA ‘seed’ sequences were considered. Hairpin constructs were based on the backbone of mir-1 with perfect complementarity between the guide and passenger strands, which favors loading onto AGO2 effector complexes. A shRNA library representing 83,256 unique synthetic hairpins was synthesized on four custom 22K Agilent microarrays, with up to six shRNAs per gene. Synthetic hairpin constructs were then amplified and cloned into pVALIUM20. The attB sequence allowed for targeted phiC31-mediated integration at genomic attP landing sites.

      Mode of assay
      Data analysis
      Cell lines
      Observed in
      Not observed in
      Comments
      Stocks (1)
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      dsRNA-HMS02171
      Secondary FlyBase IDs
        References (1)