The CRISPR guide RNA that generated Past1M10 and Past1F15 had the same 20mer target sequence:
 3R:12698125...12698144 
GAAGCGCGAGAAGAACACCC
Both alleles have the same two basepair deletion, missing nucleotides 
 3R:12698139 (A) and  3R:12698140  (C): 
GAAGCGCGAGAAGA _ _ ACCC
The deletions were identified by amplification and sequencing 833 bp PCR products in both directions using 
forward primer 5’ ATAACTGCCGTAGTCGTCGC 3’ ( 3R:12697988...12698007 ) and 
reverse primer 5’ GGAGCCGATGTAGACACGAG 3’ ( 3R:12698851...12698870 ).
These deletions are predicted to result in a frame shift and early termination codon at amino acid position 83 for both alleles. No full length or stable truncated protein was detected on westerns using a rabbit polyclonal PAST1 antibody (Figure S3 in FBrf0259199 Martin et al., 2024, PLoS Pathog. 20(3): e1011245).