Here are the position and length of the orbΔDP deletion. The start is upstream of the 5’-most TSS (orb-RG and orb-RA). The exact position of the deletion is 3R:23278934..23280864 ; those are the deleted bases. For complete clarity, here are the sequences before and after the deletion: Upstream of the deletion, before the TSS: TTTCAAACAAATGAGCGCTTTTAAGTTCAAGAGAGCGGTTGCATGCGGTTGGTTCGACAGAGCCAGGCGAAAAAGGTTATTTAAGCAGCGTTGCA Downstream of the deletion, after orb-RG exon 2: ATCAGCTGGCTTTTTCAGTTCATCTTCCCAATTGGGATTCGTGAGTGGCTGGCCCGGGATGATCCTAATAAGATTAGTGCCCAACTTTACGCCTACACTTCTGAGAGTTTTT