I am submitting a correction for the enhancer trap insertion discoC50.1S1. It is reported to be in the disco gene; however, it is not. It is in the first intron of the neighboring disco-r gene. Below is the sequence from iPCR sequencing. The first 7 bases are from the p-element, and the GCGC is the cut site. This maps to region 16148136 to 16148107 of the X chromosome, version, D mel R6.07 CATCATG GGACATACCCAGCATCTCTGCCGGCAGCGC