Interaction in vitro; bait produced as a recombinant fusion protein in bacterial system; prey produced and labeled by in vitro transcription.
Interaction in vitro; bait produced as a recombinant fusion protein produced in bacterial system; prey produced and labeled by in vitro translation.
EFmut, mutated to CUCUCUCUAGCAUGAACUCUCUCUAGCACGUGAACCUAGGAUUAAG
Interaction in vitro; bait produced as a recombinant fusion protein in bacterial system; prey produced and labeled by in vitro transcription.
Interaction in vitro; inhibitor produced as a recombinant fusion protein in bacterial system; enzyme target produced by in vitro transcription.
Sxl binds the msl-2 5\'UTR to promote translational initiation at the start codon of a short upstream open reading frame (uORF) in the 5\' UTR, instead of at the reporter\'s downstream initiation codon. Sxl-mediated translational inhibition requires both the Sxl binding site and the uORF. The presence of a short three codon uORF in the msl-2 5\' UTR about 24nt upstream of a Sxl motif is conserved in all 12 Drosophila species examined.
Positive control.
Interaction in vitro; bait produced as a recombinant fusion protein in bacterial system; prey derived from wild-type embryonic extract.
Interaction in vitro; bait produced as a recombinant fusion protein in bacterial system; prey produced and labeled by in vitro transcription.
Interaction in vitro; protein produced as recombinant fusion protein in bacterial system; mRNA produced by in vitro transcription.
Interaction in vitro; protein produced as recombinant fusion protein in bacterial system; mRNA produced by in vitro transcription.
Interaction in vitro; protein produced as recombinant fusion protein in bacterial system; mRNA produced by in vitro transcription.
Interaction in vitro; bait produced as a recombinant fusion protein in bacterial system; prey produced and labeled by in vitro transcription.
Interaction in vitro; bait produced and labeled by in vitro transcription; prey derived from wild-type adult female ovary extract.
Interaction in vitro; bait produced as a recombinant fusion protein in bacterial system; prey produced and labeled by in vitro transcription.
UUUUUUUG to (CU)4
Recombinant GST-Sxl RNA binding domain 4 was added to RNA affinity column along with embryo extract.
Interaction in vitro; bait produced and labeled by in vitro transcription; prey produced as a recombinant fusion protein in bacterial system.
Source was embryos of wild-type flies; bait produced from endogenous gene; prey produced from endogenous gene.
Positive control.
N122A, Y123A, Q126A, R244A, V246A, F248A
Source was S2 cell line; bait produced from transfected construct; prey produced from endogenous gene.
Source was Kc cell line; bait produced from endogenous; prey produced from endogenous gene.
PAR-CLIP