AGGAAACTGCTTGAGCAGCGGTGTTCTTAGCAGGAGTAATCTAACGAAGCACGGATGTTCAATTGGTAGACCTTCCGCTA ACGTTGGTTCACAGGGTGGCAAAAAGTCCATGCACTCCTCCTTGCTCTCCTCATATTCATCGAAAAT
GATCCAAATGCATTGCACAAAAAAGAAAAATAATTTATTTTTGTATACCATAAATTCTATTTCGATTTTTCTTAGCAACA ACGTAGATCTACTCTTTTCTTCTTTAATAATACAATGCATTTGACTTCGTTTTATTATACTTCTAAGTCTTAGATGTT
A BAC library containing genomic DNA fragments (average size of 21 kb) in the attB-P[acman]-CmR-BW vector for efficient transgenesis.
DNA isolated from adult fly tissue was prepared in agarose blocks and partially digested with MboI. 20-25 kb fragments were size-selected by contour-clamped homogeneous electric field (CHEF) gel electrophoresis, and ligated into the BamHi site of the attB-P[acman]-CmR-BW vector, a special adaptation of the P[acman] vector. Libraries were transformed into the E.coli strain "EPI300-T1R".
A total of 73,728 clones were generated.