Comment: 0-24 hr AEL
GGCGATTGTTGTGATGTATCGATACAACAACAACATCCCCAGCTTTCTATCTACGTCGTTCGTTGCAGCAAATAAATAAG TTTTAATTGATTGTGCGCCTTTAAAATGTACGAATTGTGGCTAATGCCGTGACCAACTGCAGAGCAGTGCCTCTAATTTT CGGCACCAGTGTAAAATCGGCGGTTCGGGGAGCAAAAGAAGCCTAAAGTGTCCATAAAACGCCAAAGGAACTGAGA
Total RNA was isolated. Gene-specific 5' RLM-RACE products were generated using the FirstChoice RLM-RACE procedure (Ambion). Primers were designed to target all FlyBase release 5.12 (October 2008) transcript models that overlap 5' ESTs from the RE (FBrf0152058) and LD (FBrf0127297) cDNA libraries. Transcripts of genes expressed in the embryo based on whole-mount RNA in situ hybridization (FBrf0205271) and literature surveys were also targeted. In all, 8570 distinct primer pairs representing 7742 genes were designed. For 1453 RACE reactions that lacked detectable product, second-round PCR conditions were used that including 5 extra amplification cycles.
Clones were not preserved and are not available for distribution.