Comment: early pupae
AGAAACTTTTGAAATTTCGGAAGATGTTGGGTGTTCTACGTATCCAAGGAGCGTTGGCTTCGGCGGGGCAGGCGCGTCTT CTGTCCGTCCGCCTGCTGGCCAGCAAATCCACCACTGACATGACCACAAACCGCGGTGAATCCACACAATCGACGTCCAC CGAACACTTTGATATAATCATCGGAGGCGGCGGACTGGTGGGCACCACATTGGCCGCAGCTCTGGCCAAGAACTCGACGT TGGCGGACAAGAAGGTACTGCTGCTGGAAGGTGCGCCCGAGTTCCGGGGATTTAATCCCACTGGGCCATACCAGAATCGC GTATCCGCCATCAATCACAACTCCATCGAGCTGTTCAAGTCCATTGATGCGTGGAAGCACATCGAGTCGGCGCGCTACAA GCCCGTCAAGCAGATGCAGGTGTGGGAGTCCAACACGGACGCACTGAT
Cloned cDNAs prepared from polyadenylated RNA isolated from larvae and early pupae.
Larvae and early pupae at various stages of development were collected from an isogenic y; cn bw sp (iso-1) strain.
RNA was poly(A)+ selected once. Oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. cDNA directionally cloned into EcoRI/XhoI-digested pOT2 plasmid. ~500,000 colonies were plated out and a mass plasmid DNA prep was done using Qiagen Plasmids containing the cDNA inserts were size selected on Sephacryl S-500 column in order to exclude plasmids with no insert. Early elutions were collected and transformed into DH5 alpha strain (Gibco/BRL).