GACCCCCGCCGGCTGGCGTTATAATCTTCAAAAGACAAATGGTCGTCTGATAGAGGTGCTCCGGATGTCGGGACCCATGC CCAAGAGAGGCGAGGCCCGTCTCCTCTTCGCCGTTGAGCCGGAGCGTATTCCCTATTATTCTGTGGTGGCGGTCGTTGGT CTGGGTAAGGAGTGCTTGGGCTATAATCCCTATGAGGT
Cloned cDNAs prepared from polyadenylated RNA isolated from adult male testes and seminal vesicles.
Adult male testes and seminal vesicles were hand dissected from 0-3 day old non-isogenic Oregon-R males from a population cage.
RNA was extracted from dissected testis and poly(A)+ selected twice (kindly provided by J. Pringle and M. Fuller). cDNA made using Stratagene ZAP-cDNA synthesis kit; oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; cDNA size fractionated on Sephacryl S-500--approximately 1-6kb. cDNA directionally cloned directly into EcoRI/XhoI-digested pOTB7 plasmid. cDNAs were transformed into DH5-alpha strain (Gibco/BRL), or for AT121nn clones, into DH5-alpha TonA.