A TI{CRIMIC.TG4.1} DNA cassette has been inserted into Atg4a, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of Atg4a downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.1} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Atg4a : one targeted to a coding intron (TGGTCAGCATGAGTCATAAGGGG) and the other to a non-coding exon in the 3' UTR (TTGGGTGCTCCACTTTCGCCTGG). The 3' end of the deletion associated with the insertion extends to within 159bp from the annotated 3' end of the CG4629 gene and may affect its proper 3' end formation.