A TI{CRIMIC.TG4.0} DNA cassette has been inserted into Tip60, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of Tip60 downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Tip60 : one targeted to a coding intron (TAGGGCGGCCTGCAAGTTTGCGG) and the other to a non-coding exon in the 3' UTR (AAGATGAGGAGATTACCATTTGG). The PCR check of the insertion gave multiple bands for the left flank and the expected sized product for the right flank. The insertion junction of the right flank was verified by sequencing. The deletion associated with the insertion is 286 bp upstream of the annotated 5' end of the tyf gene and may affect its expression. The other end of the deletion is only 19 bp from the annotated 3' end of the dgt4 gene and may affect proper mRNA 3' end formation.