A TI{KozakGAL4} DNA cassette has been inserted into Cby, replacing the coding sequence (coordinates of deleted sequence are 3R:21868093..21868784 , release 6 genome). This results in a simultaneous knock-out of Cby plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Cby (the insertion is upstream of the 5' end of the Cby-RC transcript and is not expected to trap it, but should trap the Cby-RE transcript). The insertion is also within CG31174 and is not predicted to gene trap this gene. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GGTTGCCAGTTGCATAAAATCGG and ATCAGCCTTAGTCATCGCTTAGG.