A sequence cassette has been introduced into the attP site present in TI{TI}mthl10attP, restoring the deleted mthl10 sequence and tagging it at the end of 3rd common exon (before aggtaagtgttgctctattc) with 2xTag:MYC. The tag is followed by a 2A-GAL4 cassette, resulting in the GAL4 driver being expressed as a separate protein under the control of the endogenous mthl10 regulatory sequences. A single loxP site is present downstream of the driver sequence (markers present in the progenitor insertion and donor plasmid have been removed using P1cre).