Genomic sequence of gnu (around 3kb, including regulatory elements), with GFP (plus a linker GGCGGAAGTGGAGCGGCCGCC sequence) inserted into the 3' of the gnu ORF.
Comments on Models/Modifiers Based on Experimental Evidence
( 0 )
Disease-implicated variant(s)
Phenotypic Data
Phenotypic Class
Phenotype Manifest In
Detailed Description
Statement
Reference
gnu305 mutant females lay embryos that have few giant nuclei (due to inability to undergo mitosis) while females carrying the gnuT:Avic\GFP rescue construct lay embryos that do not display any defects in embryonic mitoses.