1299bp deletion that extends from the site of the progenitor P{unk}E4365 insertion (728bp upstream of the Or88a translation start codon) to the middle of the first protein-coding exon of Or88a. This removes the first 168 amino acid residues of Or88a. 25bp of sequence (CATGATGAAATAACAATAATAGATA) is inserted at the deletion breakpoint. Part of CR44237, a predicted non-coding RNA on the opposite strand, is also removed by the deletion.
1,229 bp deletion resulting from the imprecise excision of P{unk}E4365 removes part of exon 1 of Or88a. 25 bases (catgatgaaataacaataatagata) are inserted at the site of the deletion. The deletion breakpoints are from reported sequence and are exact.
Or88aE4365-181 homozygote mutant males do not display any decrease in copulation success when courting wild-type females compared to controls.
