A TI{CRIMIC.TG4.0} DNA cassette has been inserted into Orc3, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of Orc3 downstream of the inserted gene trap cassette have been deleted. The deletion affects a dicistronic transcript that encodes CG34315 and one of the isoforms of Orc3 and thus CG34315 may also be affected. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Orc3 : one targeted to a coding intron (GAACTTTATCCAGCACCTAAAGG) and the other to a non-coding exon in the 3' UTR (GAAAAGATAAAAATACCTAAGGG). The 3' end of the deletion associated with the insertion extends to within 113 bp from the annotated 3' end of the ValRS gene and may affect proper mRNA 3' end formation.