AGCCTCCATGCAGCCCGGCGGCGGAGGACCAGGTGGACCCAGCTACAATCCCAACCAAATGGCCAGCGGCGGATCGGAGC CGGATCTCGAAACATATCCTTTCAACGAGGCGCTACTAAAGCGACTGAGTCCACTGGCGCACAGTGAGGCCTCCAACGAA AGCTACTGCGACAGCGAGCCGGAGGATCTGTCCGTGCGCTCC
Cloned random-primed cDNAs isolated from mixed stage embryos, imaginal disks, and adult heads. The strain used was not the iso-1 sequenced strain.
Mixed stage embryos, imaginal disks, and adult heads were used as a source for RNA.
All clones are from a random primed, normalized library from mixed stage embryos, imaginal disks, and adult heads.
The Exelixis ESTs were submitted to GenBank by the BDGP on behalf of Exelixis.