A TI{KozakGAL4} DNA cassette has been inserted into IntS11, replacing the coding sequence (coordinates of deleted sequence are 3R:29745425..29747431 , release 6 genome). This results in a simultaneous knock-out of IntS11 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of IntS11 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TCCACTCTCCTGCTTTCTTGCGG and TTATCTATGGAATTAAGGCGTGG.
IntS11 is expressed sparsely in the larval and adult CNS, co-localizing with a subset of cells labelled by glial and neural markers.
lethal (with Df(3R)Exel9025)
IntS11CR70043-KO-kG4/Df(3R)Exel9025 has lethal phenotype, non-suppressible by Hsap\INTS11UAS.Tag:HA/Scer\GAL4IntS11-CR70043-KO-kG4