Mutation in sequenced strain: deletion (-28).
There is a 42 base deletion and 2 base insertion in lectin-28C in iso-1, the reference sequence strain relative to cDNA GB:DQ016302. 42 bases (TGTGCCAATTAGAGGATCCTCGCAATCAATGCGGGCCATTCT) are missing between 2L:7857211 and 2L:7857214 in iso-1 and two bases (AA) are inserted. This leads to a frameshift after codon 30 and early translation termination shortly thereafter.